Red Cotton™ gRNA Plasmid Bank

location： Home > Products > Red Cotton™ gRNA Plasmid Bank >

EZ-editor™

Gene-eidting Series Products

With 15 years of experience, Ubigene has exclusively innovated and developed 6 product lines, fullfilling all kinds of needs from researchers. Experiment process simplified, efficiency improved, achieving our aim of Make genome editing easier!

Request a quote Right Now!

EZ-editor™

Gene-editing Series Products

With 14 years of experience, Ubigene has exclusivelyinnovated and developed 6 product lines, fullfilling all kinds of needs from researchers. Experiment process simplified, efficiency improved, achieving our aim of Make genome editing easier!

EZ-editor™ Gene-editing Series Products

CRISPR-iScreen™ Library

Red Cotton™ gRNA Plasmid Bank

Based on our CRISPR-U™ Technology and thousands of gene-editing success cases, Ubigene has successfully developed a series of gRNA plasmids (YKO) with high gene-editing efficiency, including regular plasmids, lentiviral plasmids, and AAV plasmids. And Ubigene has successfully established the Red Cotton™ gRNA Plasmid Bank, which is the basis of our “Red Cotton Gene Knockout Project”. Ubigene's plasmids can enter cells via regular transfection methods and can edit target sites efficiently after transient expression of high levels of Cas9 protein in target cells. Also, our plasmids can be co-transfected with a variety of gRNAs to target multiple sites in cells. At present, our Red Cotton™ gRNA Plasmid Bank has over 10000 gRNA plasmids in stock, which can be widely used in different fields of gene-editing research. You can search our in-stock gRNA plasmids according to your gene of interest.

Gene ID	Size	Price (USD)	Turnaround	Resistance	Product Name	Type of Plasmid	Catalog#	gRNA Sequence
5873	≥2ug	80	3-5(business day)	EGFP/puro/cas9	RAB27A gRNA7-gRNA8 KO plasmid	Regular Plasmid	YKO-RP003-RAB27A[gRNA7-gRNA8]	CCATGTGATTTGAAAACCG ATAAAGTGCTGCCTTGCACC	Order Strategy
468	≥2ug	80	3-5(business day)	EGFP/puro/cas9	ATF4 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-ATF4[gRNA1-gRNA2]	GGATTTGAAGGAGTTCGACT GGGGCTGCTTATTAGTCTCC	Order Strategy
55193	≥2ug	80	3-5(business day)	EGFP/puro/cas9	PBRM1 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-PBRM1[gRNA1-gRNA2]	AAAGTCCCCGCTGACACTGC TGTCAACACCAGGCCCAAGC	Order Strategy
307380	≥2ug	80	3-5(business day)	EGFP/puro	Piezo2 gRNA3-gRNA4 KO plasmid	Lentiviral Plasmid	YKO-LV001-Piezo2[gRNA3-gRNA4]	AGATCGAAGTATACAATAAG CTCATCTATGCACCTTGTTG	Order Strategy
56480	≥2ug	80	3-5(business day)	EGFP/puro/cas9	Tbk1 gRNA3-gRNA4 KO plasmid	Regular Plasmid	YKO-RP003-Tbk1[gRNA3-gRNA4]	AGAGCACCTCCAACCATCTG GCCACTGCAAATGTCTTCCG	Order Strategy
79728	≥2ug	80	3-5(business day)	EGFP/puro/cas9	PALB2 gRNA3-gRNA4 KO plasmid	Regular Plasmid	YKO-RP003-PALB2[gRNA3-gRNA4]	GCCCACAAGTTCTAATTTAG AGGATGTCTGGCACATGCAC	Order Strategy
56478	≥2ug	80	3-5(business day)	EGFP/puro/cas9	EIF4ENIF1 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-EIF4ENIF1[gRNA1-gRNA2]	AGTGAAAGAGGGATTTCGAG GAAAGGACTGGAGTACATTG	Order Strategy
17319	≥2ug	80	3-5(business day)	EGFP/puro/cas9	Mif gRNA3-gRNA4 KO plasmid	Regular Plasmid	YKO-RP003-Mif[gRNA3-gRNA4]	AGCCAAGGTGTGCCGGCGGG CTCAGCTAAGCACGTGGTCT	Order Strategy
23644	≥2ug	80	3-5(business day)	EGFP/puro/cas9	EDC4 gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-EDC4[gRNA1-gRNA2]	GGCCATCCAGTGCCTACAAT AAGACCAGTCTTGTTTGCTG	Order Strategy
55802	≥2ug	80	3-5(business day)	EGFP/puro/cas9	DCP1A gRNA1-gRNA2 KO plasmid	Regular Plasmid	YKO-RP003-DCP1A[gRNA1-gRNA2]	AATTGGGGAAATACATGAGT GCTTGATAGTACATAAATAA	Order Strategy

4 5 6 7 8

Product Name	Price (USD)
RAB27A gRNA7-gRNA8 KO plasmid	80	Order Strategy
ATF4 gRNA1-gRNA2 KO plasmid	80	Order Strategy
PBRM1 gRNA1-gRNA2 KO plasmid	80	Order Strategy
Piezo2 gRNA3-gRNA4 KO plasmid	80	Order Strategy
Tbk1 gRNA3-gRNA4 KO plasmid	80	Order Strategy
PALB2 gRNA3-gRNA4 KO plasmid	80	Order Strategy
EIF4ENIF1 gRNA1-gRNA2 KO plasmid	80	Order Strategy
Mif gRNA3-gRNA4 KO plasmid	80	Order Strategy
EDC4 gRNA1-gRNA2 KO plasmid	80	Order Strategy
DCP1A gRNA1-gRNA2 KO plasmid	80	Order Strategy

4 5 6 7 8

Subscribe Us

* E-mail：

Country/Region：

Name：

By subscription, you consent to allow Ubigene Biosciences to store and process the information provided above to deliver the latest news, research spotlight, and promotions. You can unsubscribe from these communications at anytime.